Posgrado: Sesión Práctica 2
También vamos a revisar este capítulo de BLAST:
Además de leerlo, y en lugar de control de lectura hacer (o intentar) los ejercicios del final del capítulo:
1. Which of the following in the BLAST output provides an estimate of the false
positive rate of the BLAST search: E-value, Score, or Identity?
2. What are the major advantages of Gapped-BLAST over BLASTP?
3. Use one of the BLAST programs to determine the frame shift of the following
sequence.
ATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGCACCATGCTCCTTGGGTTGT
TGATGATCCGTAGTGCTGCAGACCAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTG
GAAAGAAGCAACCACCACTCCATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTA
CATAATGTTTGGGCCACACACGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTAT
TGGCAAATGTGGCAGAAAATTTTAACATGTG
4. Use BLASTP to align protein sequence P23749 and P16235 with different matrices,
PAM30, BLOSUM45, and BLOSUM80. Which matrix gives the best alignment
score?
5. Higher eukaryotic genomes contain large amounts of repetitive DNA. The
most abundant interspersed repeat in the human genome is the Alu element. Alus
tend to occur near genes, within the introns of genes, or in the regions between
genes. In some cases, their presence and absence can fairly accurately show the
intron-exon structure of a gene. Demonstrate this by performing a nucleotidenucleotide
BLAST search against the Alu database (alu repeats) with the genomic
sequence of the human Von Hippel Lindau syndrome gene (Accession AF010238).
Note that the exons appear in the BLAST graphic as places where the Alu elements
do not align.
6. A PSI-BLAST search is most useful when you want to
1. Extend a database search to find additional proteins,
2. Extend a database search to find additional DNA sequences,
3. Find the mouse ortholog of a human protein, or
4. Use a pattern to extend a protein search.
The human fragile histidine triad protein (FHIT, Accession P49789) is structurally
related to galactose-1-phosphate uridylyltransferases. However, this relationship
is not apparent in an ordinary BLAST search. Perform a protein-protein BLAST
search against the SWISS-PROT database with P49789 and search your results for
galactose-1-phosphate uridylyltransferases. Now use PSI-BLAST to verify the relationship
between these two protein families.
7. On UCSC Genome Browser (http://genome.ucsc.edu/), find the protein sequence
for rat leptin. BLAT this sequence against the human genome to find the
human homology. Look for SNPs in the coding region of this gene. Are there any?






Una respuesta
1.- E-value. Porque depende del número de GAP’s
2.-
3.- Blastx con un frame shift de +1.
4.- PAM30: E-value=0.28, Max score=19.7, Total score=14.7, id= 22%; BLOSUM40: E-value=0.049, Max score=21.4, Total score=89.2, ID=31%; BLOSUM80: E-value=0.037, Max score=22.4, Total score=54.6, ID=21%. BLOSUM40 de un mayor valor de alineamiento =89.2.
5.- 25 Alu repeats (47.05%) con el programa Repeat masker. NO puede contestar esta pregunta más allá.
6.- BLAST: E-value=3e105, Total score=303, Max score=303, ID= 100% se parece a 5´Adenosil trifosfatasa; para galactosa -1-fosfatasa: E-value=7.6, Total score=30, Max score=30, ID= 27%. PSI-BLAST. : E-value=0.007, Total score=37.7, Max score=37.7, ID= 27% no tiene nombre la proteína. Para galactosa-1-fosfatasa: E-value=7.6, Total score=30, Max score=30, ID= 27%.
7.- 18 SNP con BLAT.
Los comentarios están cerrados.